Mixed realies and landscapes. More
All artworks on this site by Stanza
Vison of all knowledge. More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Oil on Canvas. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
Software systems. More....
All artworks on this site by Stanza
Data AI Installation
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
More...
The data body as sculpture. More ...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
Self Portrait of the artist as system of information.
Electronic sculpture. More....
Portrait of the artist as system of machine learning.
Networked sculpture. More....
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Installation for city wide public art. More....
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Public art spectacle. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Sound installtion. More
The Database Of Global Sound
Installation plays thousands of sounds from around the world.
Data scultpture. More...
Hybrid digital sculpture.
Data paintings with AI and WIFI. More....
Selected artwork uses Artificial Intelligence (AI) and Machine Learning (ML) to investigate global pollution data.
Performance. More.....
Surveillance in Public Space
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Data Sculpture. More....
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Labyrinth exhibited on 15 touch screens. More....
labyrinth exhibited on 15 touch screens
DNA system time clock. More....
Stanza DNA as artwork installation.
Systems of surveillance and control. More
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes an interwoven and entangled universe that has no borders.
Installation of city based artworks. More....
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Software Generative Art-System. More...
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Connecting city spaces through data. More....
All artworks on this site by Stanza
Visitors To A Gallery. More...
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Invisible worlds of Sound. Installation More....
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city.
Experience of data cities. More....
Intelligent city. Evolving artwork The City as System
Sounds installation. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Interactive installation plays thousands of sounds from around the world.
Real time data experience. More.....
Multiple surveillance cameras are accessed randomly in real time
Time based digital artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Privacy and alienation in the city. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More...
Machine learning and AI. More......
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Cells and viruses project.More....
Cells and viruses project, software system.
Video art systems. More.....
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
The other side of experience. More....
The computer manipulates time experiences.
Networked city. More....
a large installation adapted to each place where it is displayed that is a miniature city.
Installation of networked intelligence. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
An ever evolving artwork, always different and always expanding
More...
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
A visual labyrinth. Installation of screens.More....
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
Time based system. More....
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Using custom made software and computer techniques. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Connected space. More...
Portrait Of Artist Stanza. All artworks on this site by Stanza
Software system. More
Data Visualisation Computer,
Software System. More.....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Networked city. More....
a large installation adapted to each place where it is displayed
Using environmental data to make art. More....
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
Interactive artwork. More....
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Works on glass and mirror. More...
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data Sculpture and AI. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Environental data art. More...
All artworks on this site by Stanza
Video art systems. More...
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Analogies for the organic identity of the cityMore.....
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
Networked city. More...
a large installation adapted to each place where it is displayed.
A large installation adapted to each place where it is displayed
Connecting space and visualising the landscape. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Touch screen cities. More...
Private Collection
Installation. More
Two gold towers react to pollution data from 120 global cities.
An eco visualisation that questions the reality of how we are polluting our cities and our environment.
Data and art sculpture. More.....
Body Scan. Data Visulisation by Stanza
Portrait of the artist as system of machine learning.
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
About the perspectives of surveillance. More
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
Self Portrait of the artist as system of information.
More...
The Agency At The End Of Civilisation.
Intelligent city. Evolving artwork. More
Intelligent city. Evolving artwork
AI paintings More....
Ai and data artwork available for exhibition.
The audience as artwork. More..
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Large networked installation. More....
Available for exhibition.
Complexity series. More....
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
More....
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
Public Art. More....
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Public art installion. Projection system of real time spaces.
Time based sequential artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices.
Runs for 107 years ATCG. More...
Installation
Installation
Installation of neworked real-time data. More....
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Installation
The loss of privacy. More...
Stanza, netart, painting, networked space, installations.
Time based expression of global perpectives. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data scultpture. More...
Hybrid digital sculpture.
Video art systems. More......
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Sound art installation. More...
Installation
Installation plays thousands of sounds from around the world.
Generative software systems. More.....
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
Public art and politics. More....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Data scultpture. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Digtal Art More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Visitors are captured by the camera system in the gallery.
More...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Installation adapted to each place where it is displayed
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
Artworks on mirror or perspex. More......
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
Oil on Canvas. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Data scultpture. More...
Hybrid digital sculpture.
A digital art installation More....
The artists DNA as a building
>anipulating data and systems of surveillance into more systems of control.
Connecting city spaces through data. More...
All artworks on this site by Stanza
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Most images show events captured from across the city.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Using surveillance images to make time based art. More....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Public art and politics.More.....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes a real-time collective performance and the technology highlights how separate and stacked informational layers can be threaded to be made visible as an interwoven and entangled universe that has no borders.
DNA artworks. More
USing the artists DNA sequence.
ATCGTTCATAGTCCCATACCATTACCAATGGGATGATGTGATTAG
Performance events about agency. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. All artworks on this site by Stanza
Generative softare art. More....
Custom hardware and complex software systems as art.
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
More......
All artworks on this site by Stanza
An ever evolving artwork, always different and always expanding. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes an interwoven and entangled universe that has no borders.
Data system of complicit surveillance. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Video art systems. More......
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
AI robots and public art.More...
Portait Of The Artist Stanza
networked city wide atwork. More.....
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
Installation of sound. More....
Data as sound installation.
Live news feeds More...
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Digital generative artworks using information that bombards us online.
The networked body. More..
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
Video art systems. More..
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Mixing up data spaces. More....
Works On Canvas. All 100 cm by 100 cm and signed.
Large scale installation always different. More......
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
Sensors turn the invlsible world into sounds. More...
All artworks on this site by Stanza
All the books ever read. More....
Digital artwork by Stanza
Portrait of the artist as system of machine learning.
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
More....
All artworks on this site by Stanza
Installation. More
Invisible Landscape: Germany. A dynamic generative artwork using transport, weather, pollution data
The neural network creates patterns inside patterns of data to reform the invisible across the whole of the country.
- «
-
76
The Third Space. 2012.
All artworks on this site by Stanza
-
22
Mind Map. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
54
Control Series. 1990.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
56
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
116
Living Landscapes. 2018+
Making The invibile visible
-
50
Virus Codex. 2008.
All artworks on this site by Stanza
-
68
The Nemesis Machine. Manifestation 2023
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
-
18
Body. (Self Portrait) 2012.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
-
84
The Reader. 2015.
-
16
Capacities. 2010.
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
05
Soul Of The City. 2004.
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
85
The Binary Graffiti Club 2019.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
92
Herd Above The Noise.
The Database Of Global Sound
-
103
The Reader. 2015.
Hybrid digital sculpture.
-
104
Living Landscapes Series
Selected artwork uses Artificial Intelligence (AI) and Machine Learning (ML) to investigate global pollution data.
-
35
We Have Nothing To Hide. 2010.
Surveillance in Public Space
-
117
The Nemesis Machine. Takeover. 2022 Version
A large installation adapted to each place where it is displayed that is a miniature city.
-
09
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
39
The Central City. 1997.
labyrinth exhibited on 15 touch screens
-
10
DNA CLOCK. 2005.
Stanza DNA as artwork installation.
-
81
The Agency At The End Of Civilisation. 2014
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
-
122
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
51
The Central City. 1997.
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
14
Endless Paths. 2006.
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
-
109
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
46
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
61
Public Domain. 2008.
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
07
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city.
-
37
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork The City as System
-
82
Herd Above The Noise. Ongoing.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
17
Urban Generation. 2002
Multiple surveillance cameras are accessed randomly in real time
-
45
Parallel Reality. 2004-2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
66
Public Squares. Re-Generation. 2010.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
20
Lost In Translation. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
55
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
95
Inference Cell. 2008.
Cells and viruses project, software system.
-
87
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
70
Fortuna. 2010
The computer manipulates time experiences.
-
100
The Nemesis Machine. Manifestation 2023
a large installation adapted to each place where it is displayed that is a miniature city.
-
03
The Nemesis Machine. 2010-2019.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
43
Generative Artworks 2004.
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
-
40
Agency at The End Of Civilisation. 2014.
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
11
Parallel Realities. 2004-2010.
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
53
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
112
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
79
Entropy Through Black Matter. 2014.
Portrait Of Artist Stanza. All artworks on this site by Stanza
-
93
Syncronicity: Infinite Possibilities.
Data Visualisation Computer,
-
23
Parallel Reality. 2004
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
107
The Nemesis Machine. Manifestation 2023.
A large installation adapted to each place where it is displayed that is a miniature city.
-
124
The Nemesis Machine. Manifestation 2023
a large installation adapted to each place where it is displayed
-
27
Capacities. 2010.
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
-
64
Soul of The City. 2004.
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
24
Quantum Entanglement. 1996
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
62
Parallel Reality. 2004-2010.
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
59
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
13
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
73
Sensity. Data Cities. 2006-2009
All artworks on this site by Stanza
-
86
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
41
Networks In The Emergent City. 2010
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
99
The Nemesis Machine. 2010-2019.
a large installation adapted to each place where it is displayed.
-
48
Sensity. Data Cities. 2006- 2009
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
110
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
97
The Central City. 1997.
Private Collection
-
119
Running Out Of Time. 2023
Two gold towers react to pollution data from 120 global cities.
-
33
The Reader. 2015.
Body Scan. Data Visulisation by Stanza
-
108
The Nemesis Machine. Manifestation
A large installation adapted to each place where it is displayed that is a miniature city.
-
30
Body. 0100001001101111011001. 2014
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
-
77
The Agency At The End Of Civilisation. 2014.
The Agency At The End Of Civilisation.
-
38
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork
-
72
I Am Alive.2023 .
Ai and data artwork available for exhibition.
-
58
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
52
The Nemesis Machine. 2010- 2019.
Available for exhibition.
-
28
Surface Scars and Cuts. 2010.
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
-
69
America Is Bleeding. 2005.
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
-
49
Data Data Data. 2010.
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
06
Parallel Realities. 2004 -2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices.
-
02
DNA CLOCK. 2005
Installation
-
01
The Nemesis Machine. The Emergent City. 2019.
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
75
You Are My Subjects. 2004.
Stanza, netart, painting, networked space, installations.
-
57
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
101
The Reader. 2015.
Hybrid digital sculpture.
-
88
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
98
Herd Above The Noise.
Installation
-
19
Amorphoscapes. 2006.
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
-
78
The Binary Graffiti Club
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
113
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
105
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
12
Visitors To A Gallery: Referential Self. 2004 +
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
60
Sonicity. Invisibe Worlds. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
106
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
115
Living Landscapes. 2018+
Making The invibile visible
-
29
Quantum Entanglement. 1996
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
-
42
Control Series III. 1993.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
102
The Reader. 2015.
Hybrid digital sculpture.
-
04
Agency at The End Of Civilisation. 2014.
The artists DNA as a building
-
47
The Nemesis Machine. 2010
All artworks on this site by Stanza
-
118
The Nemesis Machine. Takeover. 2022 Version
A large installation adapted to each place where it is displayed that is a miniature city.
-
71
Urban Generation. 2002.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
21
Parallel Reality Series II. 2004-2010.
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
83
The Binary Graffiti Club. 2015.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
121
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
90
Genomixer. Using the DNA sequence. 2004
USing the artists DNA sequence.
-
08
The Binary Graffiti Club.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. All artworks on this site by Stanza
-
32
Amorphoscapes. 2004.
Custom hardware and complex software systems as art.
-
111
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
67
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
15
The Nemesis Machine. 2010-2019.
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
123
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
63
The Agency At The End Of Civilisation. 2014.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
89
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
96
Lost In Translation. 2015.
Portait Of The Artist Stanza
-
25
Urban Generation. 2002
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
-
26
Sonicity. 2010.
Data as sound installation.
-
65
All Tomorrows Stories. 2002.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
80
Body 1010101. 2012.
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
-
91
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
74
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
94
The Third Space. 2012
Works On Canvas. All 100 cm by 100 cm and signed.
-
31
The Emergent City. At FOS 2019
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
-
44
Sonicity. Invisible Worlds of Data. 2010
All artworks on this site by Stanza
-
36
The Reader. Data Sculture. 2015.
Digital artwork by Stanza
-
114
Living Landscapes. 2018+
Making The invibile visible
-
34
The Emergent City at FOS 2019
All artworks on this site by Stanza
-
120
Living Systems 2023
Invisible Landscape: Germany. A dynamic generative artwork using transport, weather, pollution data
- »
- Pause
Frontpage Slideshow (standalone) | Copyright © 2006-2011 JoomlaWorks Ltd.
Welcome: This website shows only artwork made by Stanza; please enjoy. These artworks include installations, public art, generative data, paintings, prints and netart. He is the recipient of twenty five international art prizes and awards. All artwork on this site is made between 1982 and 2024.
News: Recent exhibitions include:- Deutsches Museum Nuremberg, Samek Art Museum USA, Heinz Nixdorf Museum Germany, Rijksmueum Twente Netherlands, Jarvenpaa Art Museum Finland, Centrequatre104 Paris France, La Filature Mulhouse France. Living Landscapes series of AI and Machine learning systems with global data from my API is touring to Germany, Stanza music performance live with Soundcities soundscapes project in Enschede and in Rotterdam. Velocity the new machine learning tracking app released and exhibited in three art galleries simultaneously. STARTS EU arts residency at MEET Milano for 2024 for my new AI work about cities and entanglement.
Main projects include: The Emergent City, visual artworks informed by idea the city is system of data. Genomixer artworks are made using the artist's DNA sequence. Soundcities an online database and installation of thousands of field recordings from around the world. Sensity visualises the city of environmental data as a living system. Urban Generation incorporates surveillance feeds to make a generative artwork. Visitors to A Gallery and Public Domain uses gallery visitors inside a surveillance system.
Commissions, and exhibition requests. All work is for sale, inquiries welcome.
EMAIL
STUDIO@STANZA.CO.UK
All artwork © Stanza 1982- 2024. |
|
|
|